Trematode mitochondrial code
The trematode mitochondrial code (translation table 21) is a genetic code found in the mitochondria of Trematoda.
Code
[edit | edit source]AAs = FFLLSSSSYY**CCWWLLLLPPPPHHQQRRRRIIMMTTTTNNNKSSSSVVVVAAAADDEEGGGGStarts = -----------------------------------M---------------M------------Base1 = TTTTTTTTTTTTTTTTCCCCCCCCCCCCCCCCAAAAAAAAAAAAAAAAGGGGGGGGGGGGGGGGBase2 = TTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGBase3 = TCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAG
Bases: adenine (A), cytosine (C), guanine (G) and thymine (T) or uracil (U).
Amino acids: Alanine (Ala, A), Arginine (Arg, R), Asparagine (Asn, N), Aspartic acid (Asp, D), Cysteine (Cys, C), Glutamic acid (Glu, E), Glutamine (Gln, Q), Glycine (Gly, G), Histidine (His, H), Isoleucine (Ile, I), Leucine (Leu, L), Lysine (Lys, K), Methionine (Met, M), Phenylalanine (Phe, F), Proline (Pro, P), Serine (Ser, S), Threonine (Thr, T), Tryptophan (Trp, W), Tyrosine (Tyr, Y), Valine (Val, V)
Differences from the standard code
[edit | edit source]| DNA codons | RNA codons | This code (21) | Standard code (1) | |
|---|---|---|---|---|
| TGA | UGA | Trp (W) | STOP = Ter (*) | |
| ATA | AUA | Met (M) | Ile (I) | |
| AGA | AGA | Ser (S) | Arg (R) | |
| AGG | AGG | Ser (S) | Arg (R) | |
| AAA | AAA | Asn (N) | Lys (K) |
Systematic range and comments
[edit | edit source]See also
[edit | edit source]References
[edit | edit source]This article incorporates text from the United States National Library of Medicine, which is in the public domain. [3]
- ^ Evolution of the mitochondrial genetic code. IV. AAA as an asparagine codon in some animal mitochondria. Ohama, T, S. Osawa, K. Watanabe, T.H. Jukes, 1990. J. Molec Evol. 30
- ^ Platyhelminth mitochondrial DNA: evidence for early evolutionary origin of a tRNA(serAGN) that contains a dihydrouridine arm replacement loop, and of serine-specifying AGA and AGG codons Garey, J.R. and D.R. Wolstenholme, 1989. J. Molec. Evol. 28: 374-387 329-332.
- ^ Lua error in Module:Citation/CS1/Configuration at line 2172: attempt to index field '?' (a nil value).
Lua error in Module:Authority_control at line 153: attempt to index field 'wikibase' (a nil value).
