Peritrich nuclear code
The peritrich nuclear code (translation table 30) is a genetic code used by the nuclear genome of the peritrich ciliates Vorticella and Opisthonecta.[1]
The code (30)
[edit | edit source]AAs = FFLLSSSSYYEECC*WLLLAPPPPHHQQRRRRIIIMTTTTNNKKSSRRVVVVAAAADDEEGGGGStarts = --------------*--------------------M----------------------------Base1 = TTTTTTTTTTTTTTTTCCCCCCCCCCCCCCCCAAAAAAAAAAAAAAAAGGGGGGGGGGGGGGGGBase2 = TTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGBase3 = TCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAG
Bases: adenine (A), cytosine (C), guanine (G) and thymine (T) or uracil (U).
Amino acids: Alanine (Ala, A), Arginine (Arg, R), Asparagine (Asn, N), Aspartic acid (Asp, D), Cysteine (Cys, C), Glutamic acid (Glu, E), Glutamine (Gln, Q), Glycine (Gly, G), Histidine (His, H), Isoleucine (Ile, I), Leucine (Leu, L), Lysine (Lys, K), Methionine (Met, M), Phenylalanine (Phe, F), Proline (Pro, P), Serine (Ser, S), Threonine (Thr, T), Tryptophan (Trp, W), Tyrosine (Tyr, Y), and Valine (Val, V).
Differences from the standard code
[edit | edit source]| DNA codons | RNA codons | This code (30) | Standard code (1) | |
|---|---|---|---|---|
| TAA | UAA | Glu (E) | Ter (*) | |
| TAG | UAG | Glu (E) | Ter (*) |
See also
[edit | edit source]- List of all genetic codes: translation tables 1 to 16, and 21 to 31.
- The genetic codes database.
References
[edit | edit source]This article incorporates text from the United States National Library of Medicine, which is in the public domain. [2]
Lua error in Module:Authority_control at line 153: attempt to index field 'wikibase' (a nil value).