Cephalodiscidae mitochondrial code
The Cephalodiscidae mitochondrial code (translation table 33) is a genetic code used by the mitochondrial genome of Cephalodiscidae (Pterobranchia). The Pterobranchia are one of the two groups in the Hemichordata which together with the Echinodermata and Chordata form the major clades of deuterostomes.
Code 33 is very similar to the mitochondrial code 24 for the Pterobranchia, which also belong to the Hemichordata, except that it uses UAA for tyrosine rather than as a stop codon.[1]
This code shares with many other mitochondrial codes the reassignment of the UGA STOP to tryptophan, and AGG and AGA to an amino acid other than arginine. However, the assignment of AGG to lysine in pterobranchian mitogenomes is not found elsewhere in deuterostome mitochondria but it occurs in some taxa of Arthropoda.[2]
The code
[edit | edit source]AAs = FFLLSSSSYYY*CCWWLLLLPPPPHHQQRRRRIIIMTTTTNNKKSSSKVVVVAAAADDEEGGGGStarts = ---M-------*-------M---------------M---------------M------------Base1 = TTTTTTTTTTTTTTTTCCCCCCCCCCCCCCCCAAAAAAAAAAAAAAAAGGGGGGGGGGGGGGGGBase2 = TTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGBase3 = TCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAG
Bases: adenine (A), cytosine (C), guanine (G) and thymine (T) or uracil (U).
Amino acids: Alanine (Ala, A), Arginine (Arg, R), Asparagine (Asn, N), Aspartic acid (Asp, D), Cysteine (Cys, C), Glutamic acid (Glu, E), Glutamine (Gln, Q), Glycine (Gly, G), Histidine (His, H), Isoleucine (Ile, I), Leucine (Leu, L), Lysine (Lys, K), Methionine (Met, M), Phenylalanine (Phe, F), Proline (Pro, P), Serine (Ser, S), Threonine (Thr, T), Tryptophan (Trp, W), Tyrosine (Tyr, Y), Valine (Val, V).
Differences from the standard code
[edit | edit source]| DNA codons | RNA codons | This code (33) | Standard code (1) | |
|---|---|---|---|---|
TAA |
UAA |
Tyr (Y) |
STOP = Ter (*)
| |
TGA |
UGA |
Trp (W) |
STOP = Ter (*)
| |
AGA |
AGA |
Ser (S) |
Arg (R)
| |
AGG |
AGG |
Lys (K) |
Arg (R)
|
See also
[edit | edit source]References
[edit | edit source]This article incorporates text from the United States National Library of Medicine, which is in the public domain. [3]
- ^ Lua error in Module:Citation/CS1/Configuration at line 2172: attempt to index field '?' (a nil value).
- ^ Lua error in Module:Citation/CS1/Configuration at line 2172: attempt to index field '?' (a nil value).
- ^ Lua error in Module:Citation/CS1/Configuration at line 2172: attempt to index field '?' (a nil value).