Alternative yeast nuclear code
The alternative yeast nuclear code (translation table 12) is a genetic code found in certain yeasts. However, other yeast, including Saccharomyces cerevisiae, Candida azyma, Candida diversa, Candida magnoliae, Candida rugopelliculosa, Yarrowia lipolytica, and Zygoascus hellenicus, definitely use the standard (nuclear) code.[1]
The code
[edit | edit source]AAs = FFLLSSSSYY**CC*WLLLSPPPPHHQQRRRRIIIMTTTTNNKKSSRRVVVVAAAADDEEGGGGStarts = -------------------M---------------M----------------------------Base1 = TTTTTTTTTTTTTTTTCCCCCCCCCCCCCCCCAAAAAAAAAAAAAAAAGGGGGGGGGGGGGGGGBase2 = TTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGBase3 = TCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAG
Bases: adenine (A), cytosine (C), guanine (G) and thymine (T) or uracil (U).
Amino acids: Alanine (Ala, A), Arginine (Arg, R), Asparagine (Asn, N), Aspartic acid (Asp, D), Cysteine (Cys, C), Glutamic acid (Glu, E), Glutamine (Gln, Q), Glycine (Gly, G), Histidine (His, H), Isoleucine (Ile, I), Leucine (Leu, L), Lysine (Lys, K), Methionine (Met, M), Phenylalanine (Phe, F), Proline (Pro, P), Serine (Ser, S), Threonine (Thr, T), Tryptophan (Trp, W), Tyrosine (Tyr, Y), Valine (Val, V).
Differences from the standard code
[edit | edit source]| DNA codons | RNA codons | This code (12) | Standard code (1) | |
|---|---|---|---|---|
CTG |
CUG |
Ser (S) |
Leu (L)
|
Alternative initiation codons
[edit | edit source]- CAG may be used in Candida albicans.[2]
Systematic range
[edit | edit source]- Endomycetales (yeasts): Candida albicans, Candida cylindracea, Candida melibiosica, Candida parapsilosis, and Candida rugosa.[1]
See also
[edit | edit source]References
[edit | edit source]This article incorporates text from the United States National Library of Medicine, which is in the public domain. [3]
- ^ a b Lua error in Module:Citation/CS1/Configuration at line 2172: attempt to index field '?' (a nil value).
- ^ Lua error in Module:Citation/CS1/Configuration at line 2172: attempt to index field '?' (a nil value).
- ^ Lua error in Module:Citation/CS1/Configuration at line 2172: attempt to index field '?' (a nil value).
Lua error in Module:Authority_control at line 153: attempt to index field 'wikibase' (a nil value).
 | This genetics article is a stub. You can help Wikipedia by expanding it. |